Sequence ID | >WENV180212095 |
Genome ID | OBAM01095672 |
Search identical group | |
Phylum/Class | [OBAM] human gut metagenome; human gut |
Species | |
Start position on genome | 181 |
End posion on genome | 95 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tcccttccat |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTAGGTTCAGGGTCTAGTGAAGGTTCCTTCATG |
Downstream region at tRNA end position |
accaagaatc |
Secondary structure (Cloverleaf model) | >WENV180212095 Leu CAG t ACCA accaagaatc G - C C - G C - G G - C A - T A - T G - C T G T C C C T C A T A A G | | | | | G T G G T G G G G A G C G | | | T T G A C A C T A G G TGAAGGTTCCTTCAT C - G T - A A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |