Sequence ID | >WENV180217906 |
Genome ID | OBAR01007447 |
Search identical group | |
Phylum/Class | [OBAR] human gut metagenome; human gut |
Species | |
Start position on genome | 4266 |
End posion on genome | 4341 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gcatagattt |
tRNA gene sequence |
AGGGGTATAGCTCAGTTGGTAGAGCAGCGGTCTCCAAAACCGCGTGCCGTGAGTTCGAGA |
Downstream region at tRNA end position |
caaacgcaca |
Secondary structure (Cloverleaf model) | >WENV180217906 Trp CCA t GCCA caaacgcaca A - T G - C G - C G - C G - C T - A A - T A G T C A T T C A T G A A | | + | | G T C T C G G T G A G C G | | | | T T G G A G C T A A GTGCC G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |