Sequence ID | >WENV180220927 |
Genome ID | OBAX01000250 |
Search identical group | |
Phylum/Class | [OBAX] human gut metagenome; human gut |
Species | |
Start position on genome | 397 |
End posion on genome | 473 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
taagttagtT |
tRNA gene sequence |
GCTCCGATAGTGTAGTCCGGCCAATCATTTCGGCCTTTCGAGCCGAAGACTCGGGTTCGA |
Downstream region at tRNA end position |
aatttatgtt |
Secondary structure (Cloverleaf model) | >WENV180220927 Glu TTC T ATtt aatttatgtt G - C C - G T - A C - G C - G G - C A - T T A T G G C C C A C T G A A + | | | | G C T G T G T C G G G C G | | + T T G T C A T C C A A T AGAC T - A C - G G - C G - C C - G C A T G T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |