Sequence ID | >WENV180235355 |
Genome ID | OBCT01095963 |
Search identical group | |
Phylum/Class | [OBCT] human gut metagenome; human gut |
Species | |
Start position on genome | 85 |
End posion on genome | 160 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ccacaatcat |
tRNA gene sequence |
GGGCGATTAGCTCAGCTGGGAGAGCGCCTGCCTTACAAGCAGGATGTCAGCAGTTCGATC |
Downstream region at tRNA end position |
ggaaaaaaag |
Secondary structure (Cloverleaf model) | >WENV180235355 Val TAC t ACCA ggaaaaaaag G - C G - C G - C C - G G - C A - T T - A C T T T T G T C A C G A A | + | | | G T C T C G A G C A G C G | | | | T T G G A G C G A G ATGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |