Sequence ID | >WENV180259782 |
Genome ID | OBEQ011138672 |
Search identical group | |
Phylum/Class | [OBEQ] groundwater metagenome; groundwater |
Species | |
Start position on genome | 17 |
End posion on genome | 92 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
actgccactt |
tRNA gene sequence |
GGGCCCTTAGCTCAGCTGGTAGAGCGCCTGCATGGCATGCATGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
cgtaaaaaca |
Secondary structure (Cloverleaf model) | >WENV180259782 Ala GGC t ACCA cgtaaaaaca G - C G - C G + T C - G C - G C - G T - A C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G AGGTC C - G C T T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |