Sequence ID | >WENV180263921 |
Genome ID | OBEQ011519429 |
Search identical group | |
Phylum/Class | [OBEQ] groundwater metagenome; groundwater |
Species | |
Start position on genome | 239 |
End posion on genome | 314 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gtttcagcgt |
tRNA gene sequence |
GGCGAATTAGCTCAGTGGTTAGAGCAGAGGAATCATAATCCTTTGGTCCGGGGTTCAAAT |
Downstream region at tRNA end position |
attaccttta |
Secondary structure (Cloverleaf model) | >WENV180263921 Met CAT t ACCA attaccttta G - C G - C C - G G - C A - T A - T T - A T A T G T C C C A T G A A | + | | | A G C T C G C G G G G C G | | | | T T T G A G C T A A TGGTC G + T A - T G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |