| Sequence ID | >WENV180267625 |
| Genome ID | OBEQ011875873 |
| Phylum/Class | [OBEQ] groundwater metagenome; groundwater |
| Species | |
| Start position on genome | 152 |
| End posion on genome | 76 |
| Amino Acid | Arg |
| Anticodon | CCG |
| Upstream region at tRNA start position |
tttcagattt |
| tRNA gene sequence |
GCGCCCTTAGCTCAGCTGGATAGAGCGTCAGCCTCCGACGCTGAAGGTCAGAGGTTCGAA |
| Downstream region at tRNA end position |
gtttcaacgc |
| Secondary structure (Cloverleaf model) | >WENV180267625 Arg CCG
t ACCA gtttcaacgc
G - C
C - G
G - C
C - G
C - G
C - G
T - A T A
T T C T C C A
C G A A | | | | | G
T C T C G A G A G G C
G | | | | T T
G G A G C
A T A G AGGTC
T - A
C - G
A - T
G - C
C - G
C C
T A
C C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |