Sequence ID | >WENV180269557 |
Genome ID | OBEQ012077553 |
Search identical group | |
Phylum/Class | [OBEQ] groundwater metagenome; groundwater |
Species | |
Start position on genome | 19902 |
End posion on genome | 19829 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
atttgttcgt |
tRNA gene sequence |
GGCTGGGTGGCAGAGTGGTCATGCAGCGGACTGCAAATCCGTGTACGCCGGTTCAATTCC |
Downstream region at tRNA end position |
tttcctcttc |
Secondary structure (Cloverleaf model) | >WENV180269557 Cys GCA t TCCA tttcctcttc G - C G - C C - G T - A G - C G - C G - C T T T C A G C C A G A G | | | | A T G A C G G C C G G C G | | | T T G A T G C T C A GTAC G + T C - G G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |