Sequence ID | >WENV180275454 |
Genome ID | OBHT01036224 |
Search identical group | |
Phylum/Class | [OBHT] metagenome; hydrothermal vent |
Species | |
Start position on genome | 162 |
End posion on genome | 88 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
atattattaa |
tRNA gene sequence |
GCCCGGGTAGCTCAGCCTGGGAGAGCGCGCGGCTGAAGACCGCGTAGTCCCCGGTTCAAA |
Downstream region at tRNA end position |
ttcttcccat |
Secondary structure (Cloverleaf model) | >WENV180275454 Phe GAA a ACtc ttcttcccat G - C C - G C - G C - G G - C G - C G + T T A T G G G C C A C G A A | | | | | A C C T C G C C C G G C T | | | | T T G G A G C G G A G TAGTC C - G G - C C - G G - C G - C C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |