Sequence ID | >WENV180278413 |
Genome ID | OBHX01003928 |
Search identical group | |
Phylum/Class | [OBHX] metagenome; feces |
Species | |
Start position on genome | 765 |
End posion on genome | 841 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
aatttaataa |
tRNA gene sequence |
GCACCTATAGCTCAGCTGGATAGAGCGTTGGACTTCGAATCCAAGCGTCGCAGGTTCGAC |
Downstream region at tRNA end position |
aaagaagtga |
Secondary structure (Cloverleaf model) | >WENV180278413 Arg TCG a ACCA aaagaagtga G + T C - G A - T C - G C - G T - A A - T T C T T G T C C A C G A A + | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A G GCGTC T - A T - A G - C G - C A - T C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |