Sequence ID | >WENV180280082 |
Genome ID | OBHX01227949 |
Search identical group | |
Phylum/Class | [OBHX] metagenome; feces |
Species | |
Start position on genome | 131 |
End posion on genome | 57 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ttctcgattt |
tRNA gene sequence |
GGGGGATTAGCTCAGTTGGCTAGAGCACCTGCTTTGCAAGCAGGGGGTCAACGGTTCGAA |
Downstream region at tRNA end position |
tgccttttaa |
Secondary structure (Cloverleaf model) | >WENV180280082 Ala TGC t ACta tgccttttaa G - C G - C G + T G - C G + T A - T T - A T A T T T G C C A T G A A | | | | | G T C T C G A A C G G C G | | | | T T G G A G C C T A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |