Sequence ID | >WENV180283918 |
Genome ID | OBID01006423 |
Search identical group | |
Phylum/Class | [OBID] metagenome; sludge |
Species | |
Start position on genome | 3295 |
End posion on genome | 3219 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aattttttat |
tRNA gene sequence |
GCTTCCATAGCTCAGCTGGATAGAGCAACGCCCTTCTAAGGCGTAGGCCGTACGTTCGAA |
Downstream region at tRNA end position |
ttttggttta |
Secondary structure (Cloverleaf model) | >WENV180283918 Arg TCT t ACCA ttttggttta G + T C - G T - A T + G C - G C - G A - T T A T C A T G C A C G A A | | | | | G T C T C G G T A C G C G | | | | T T G G A G C A T A A AGGCC A - T C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |