Sequence ID | >WENV180290535 |
Genome ID | OBIU01036208 |
Search identical group | |
Phylum/Class | [OBIU] human gut metagenome; human gut |
Species | |
Start position on genome | 671 |
End posion on genome | 596 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
nnnnnnttaT |
tRNA gene sequence |
TGGGCATTCGCCAAATTGGTAAGGCAGTGGACTCTGAATCCATAATTTACAGGTTCGAAC |
Downstream region at tRNA end position |
ctttgatatt |
Secondary structure (Cloverleaf model) | >WENV180290535 Gln CTG T ATCt ctttgatatt T - A G - C G - C G - C C - G A - T T - A C A T T G T C C A T A A C | | | | | G T A C C G A C A G G C G | | | T T G A G G C T A A AATTT G + T T - A G - C G - C A - T C A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |