Sequence ID | >WENV180291455 |
Genome ID | OBIV01062501 |
Search identical group | |
Phylum/Class | [OBIV] soil metagenome; Clay |
Species | |
Start position on genome | 405 |
End posion on genome | 329 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ctcaccgcac |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGTTGGCCTCCGGAGCCAAAGGCCGCAGGTTCGAA |
Downstream region at tRNA end position |
gccttcgctc |
Secondary structure (Cloverleaf model) | >WENV180291455 Arg CCG c GCCA gccttcgctc G - C C - G G - C C - G C - G C - G G - C T A T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A G AGGCC T - A T - A G - C G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |