| Sequence ID | >WENV180295027 |
| Genome ID | OBIZ01012584 |
| Phylum/Class | [OBIZ] soil metagenome; soil |
| Species | |
| Start position on genome | 920 |
| End posion on genome | 846 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
ttgtcggaac |
| tRNA gene sequence |
AGGCGCGTAGCTCAGGGGGAGAGCGCTACCTTGACACGGTAGAGGTCGGCGGTTCGAAAC |
| Downstream region at tRNA end position |
ttttaagatc |
| Secondary structure (Cloverleaf model) | >WENV180295027 Val GAC
c ACCA ttttaagatc
A - T
G - C
G - C
C - G
G + T
C - G
G - C A A
T C C G C C A
G A A | | | | | G
G C T C G G G C G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
T - A
A - T
C - G
C - G
T C
T A
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |