Sequence ID | >WENV180296896 |
Genome ID | OBJA01004344 |
Search identical group | |
Phylum/Class | [OBJA] soil metagenome; sediment, water from around vicinity |
Species | |
Start position on genome | 3153 |
End posion on genome | 3237 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tgttgtgaaa |
tRNA gene sequence |
GCCGAAGTGGTGGAACTGGTAGACACGCTATCTTGAGGGGGTAGTGGGGCAACCCGTGCG |
Downstream region at tRNA end position |
ggttgatttt |
Secondary structure (Cloverleaf model) | >WENV180296896 Leu GAG a ACCA ggttgatttt G - C C - G C - G G - C A - T A - T G - C T G T C G C T C A C A A G | | | | | G T G G T G G C G A G C G | | | T T G A C A C T A G G TGGGGCAACCCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |