Sequence ID | >WENV180297367 |
Genome ID | OBJA01025910 |
Search identical group | |
Phylum/Class | [OBJA] soil metagenome; sediment, water from around vicinity |
Species | |
Start position on genome | 1448 |
End posion on genome | 1524 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcgctaccat |
tRNA gene sequence |
GGCGGCGTAGCTCAGTTGGTTAGAGCATCGGAATCATAATCCGAGTGTCCGGGGTTCAAG |
Downstream region at tRNA end position |
tttttttgcg |
Secondary structure (Cloverleaf model) | >WENV180297367 Met CAT t ACCA tttttttgcg G + T G - C C - G G - C G - C C - G G - C T G T G T C C C A T G A A | + | | | A T C T C G C G G G G C G | | | | T T G G A G C T T A A GTGTC T - A C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |