Sequence ID | >WENV180297736 |
Genome ID | OBJA01073180 |
Search identical group | |
Phylum/Class | [OBJA] soil metagenome; sediment, water from around vicinity |
Species | |
Start position on genome | 182 |
End posion on genome | 90 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tcaatgcagt |
tRNA gene sequence |
GGAGAGATGGCCGAGTCGGCTGAAGGCGCTCGCCTGCTAAGCGAGTGTGGGGGGAAACTT |
Downstream region at tRNA end position |
ttttgattca |
Secondary structure (Cloverleaf model) | >WENV180297736 Ser GCT t GCCA ttttgattca G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A C T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A G TGTGGGGGGAAACTTCCACC C - G T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |