Sequence ID | >WENV180310880 |
Genome ID | OBJT01043030 |
Search identical group | |
Phylum/Class | [OBJT] soil metagenome; soil |
Species | |
Start position on genome | 471 |
End posion on genome | 395 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gccgctcttc |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTACTGCCCTCCGAAGGCAGGGGTCGTGCGTTCGAA |
Downstream region at tRNA end position |
gttttccggt |
Secondary structure (Cloverleaf model) | >WENV180310880 Arg CCG c GCCA gttttccggt G - C C - G G - C C - G C - G C - G G - C T A T C G C G C A C G A A | + | | | G T C T C G G T G C G C G | | | + T T G G A G T A T A A GGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |