Sequence ID | >WENV180311676 |
Genome ID | OBJT01463978 |
Search identical group | |
Phylum/Class | [OBJT] soil metagenome; soil |
Species | |
Start position on genome | 129 |
End posion on genome | 200 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccgcccccac |
tRNA gene sequence |
GGTGGAGTGGCCGAGAGGCGAGGCAACGGCCTGCAAAGCCGTGTACACGGGTTCAAATCC |
Downstream region at tRNA end position |
gctccccgag |
Secondary structure (Cloverleaf model) | >WENV180311676 Cys GCA c TCgg gctccccgag G - C G - C T - A G - C G - C A - T G - C T A T T G C C C A G A G | | | | | A A G C C G A C G G G C G | | | T T G A G G C C G A GTAC A - T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |