| Sequence ID | >WENV180316861 |
| Genome ID | OBKJ01000318 |
| Phylum/Class | [OBKJ] metagenome; hydrothermal vent |
| Species | |
| Start position on genome | 1713 |
| End posion on genome | 1640 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
agagaaaatt |
| tRNA gene sequence |
AGCCCGGTGGTGTAGTGGCCAATCATACGAGACTTTGAATCTCGTTACCGCGGTTCGAAT |
| Downstream region at tRNA end position |
tttattttat |
| Secondary structure (Cloverleaf model) | >WENV180316861 Gln TTG
t ACtt tttattttat
A - T
G - C
C - G
C - G
C - G
G - C
G + T T A
T G C G C C A
T G A G | | | | | G
G T G T G C G C G G C
G | | + T T
C T C A T
C A A A TTAC
C - G
G - C
A - T
G - C
A - T
C A
T A
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |