Sequence ID | >WENV180316924 |
Genome ID | OBKJ01001821 |
Search identical group | |
Phylum/Class | [OBKJ] metagenome; hydrothermal vent |
Species | |
Start position on genome | 346 |
End posion on genome | 271 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ataattaaat |
tRNA gene sequence |
GCTCCAGTGGTGTAGTCCGGCCAATCATGCAGGCCTTTCGAGCCTGCGACTCGGGTTCAA |
Downstream region at tRNA end position |
tatattatta |
Secondary structure (Cloverleaf model) | >WENV180316924 Glu TTC t ACtt tatattatta G - C C - G T - A C - G C - G A - T G - C T A T G G C C C A C T G A G + | | | | A C T G T G T C G G G C G | | + T T G T C A T C C A A G CGAC C - G A - T G - C G - C C - G C A T G T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |