Sequence ID | >WENV180318985 |
Genome ID | OBKM01133504 |
Search identical group | |
Phylum/Class | [OBKM] metagenome; water |
Species | |
Start position on genome | 89 |
End posion on genome | 8 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
nnnnnnnnga |
tRNA gene sequence |
GCCAGGATGGCCGAGTGGTAAGGCGCACGCCTGGAAAGCGTGTTCCCTTCCGGGATCGGG |
Downstream region at tRNA end position |
tcgannnnnn |
Secondary structure (Cloverleaf model) | >WENV180318985 Ser GGA a Gttt tcgannnnnn G - C C - G C - G A - T G - C G - C A - T T A T C T C C C A G A G | + | | | A T G C C G G G G G G C G | | | T T G A G G C T A G TTCCCTTCCGGGATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |