Sequence ID | >WENV180332533 |
Genome ID | OBLD01035250 |
Search identical group | |
Phylum/Class | [OBLD] metagenome; water |
Species | |
Start position on genome | 112 |
End posion on genome | 38 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ccatatcgga |
tRNA gene sequence |
TGGGGCGTCGTCAAGCGGTAAGACACAAGGTTTTGATCCTTGCATTCGGGGGTTCGAATC |
Downstream region at tRNA end position |
actgttttat |
Secondary structure (Cloverleaf model) | >WENV180332533 Gln TTG a GCCA actgttttat T - A G - C G - C G - C G - C C - G G - C T A T C T C C C A G A C | + | | | G C A C T G G G G G G C G | | | T T G A G A C T A A CATTC C - G A - T A - T G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |