Sequence ID | >WENV180333002 |
Genome ID | OBLF01000094 |
Search identical group | |
Phylum/Class | [OBLF] metagenome; feces |
Species | |
Start position on genome | 32630 |
End posion on genome | 32703 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ttcccccgtt |
tRNA gene sequence |
GGGGCTATAGCGCAGCTGGTAGCGCATCTGCTTTGCAAGCAGAGGGTCCCCGGTTCGAAC |
Downstream region at tRNA end position |
gcatggtcgt |
Secondary structure (Cloverleaf model) | >WENV180333002 Ala TGC t ACtc gcatggtcgt G - C G - C G + T G - C C - G T - A A - T C A T G G G C C A C G A A | | | | | G T C G C G C C C G G C G | | | | T T G G C G C T A A GGGTC T - A C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |