| Sequence ID | >WENV180333987 |
| Genome ID | OBLF01003540 |
| Phylum/Class | [OBLF] metagenome; feces |
| Species | |
| Start position on genome | 4342 |
| End posion on genome | 4272 |
| Amino Acid | Gly |
| Anticodon | CCC |
| Upstream region at tRNA start position |
taactcatat |
| tRNA gene sequence |
GCGAATGTAGTTTAGTGGTAAAATTCAAGCTTCCCAAGCTTGTGTCGCGGGTTCGATTCC |
| Downstream region at tRNA end position |
ctgaaaaaca |
| Secondary structure (Cloverleaf model) | >WENV180333987 Gly CCC
t Ttca ctgaaaaaca
G - C
C - G
G - C
A - T
A - T
T - A
G - C T T
T T G C C C A
G A A + | | | | G
T T T T G G C G G G C
G | | | + T T
G A A A T
T A T TGTC
C - G
A - T
A - T
G - C
C - G
T A
T A
C C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |