Sequence ID | >WENV180338918 |
Genome ID | OBLI01001413 |
Search identical group | |
Phylum/Class | [OBLI] pig gut metagenome; faeces |
Species | |
Start position on genome | 22997 |
End posion on genome | 23073 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tgtgccctgt |
tRNA gene sequence |
GCGCCCATAGCTCAGCTGGATAGAGCAGCAGTTTCCTAAACTGCGTGTCGGATGTTCGAG |
Downstream region at tRNA end position |
tttttttatc |
Secondary structure (Cloverleaf model) | >WENV180338918 Arg CCT t ACCA tttttttatc G - C C - G G - C C - G C - G C - G A - T T G T T C T A C A C G A A + | | | | G T C T C G G G A T G C G | | | | T T G G A G C A T A A GTGTC G - C C - G A - T G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |