Sequence ID | >WENV180343476 |
Genome ID | OBLK01023355 |
Search identical group | |
Phylum/Class | [OBLK] soil metagenome; Clay |
Species | |
Start position on genome | 589 |
End posion on genome | 665 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
ccgctcatca |
tRNA gene sequence |
GGGCCTATAGCTCAATCGGTTAGAGCAGCGGACTCATAATCCGTTGGTTCCAGGTTCAAG |
Downstream region at tRNA end position |
tactcttcca |
Secondary structure (Cloverleaf model) | >WENV180343476 Ile2 CAT a ACCA tactcttcca G - C G - C G - C C - G C - G T + G A - T T G T G G T C C A T A A A | | | | | A C C T C G C C A G G C G | | | | T T G G A G C T T A A TGGTT G + T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |