Sequence ID | >WENV180353711 |
Genome ID | OBLQ010981251 |
Search identical group | |
Phylum/Class | [OBLQ] soil metagenome; soil |
Species | |
Start position on genome | 225 |
End posion on genome | 141 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tatatattca |
tRNA gene sequence |
GGTGGGGTTCCCGAGTGGTCAAAGGGAACAGACTGTAAATCTGTCGGCGAAGCCTTCGGA |
Downstream region at tRNA end position |
gcctcaaagt |
Secondary structure (Cloverleaf model) | >WENV180353711 Tyr GTA a ACCA gcctcaaagt G - C G - C T - A G - C G - C G - C G - C T A T C C T C C A T G A T | | | | | A G G C C C G G A G G C G | | | T T T A G G G C A A A CGGCGAAGCCTTC A - T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |