| Sequence ID | >WENV180358096 |
| Genome ID | OBNP01000170 |
| Phylum/Class | [OBNP] marine metagenome; seawater |
| Species | |
| Start position on genome | 2643 |
| End posion on genome | 2718 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
cgatgttttg |
| tRNA gene sequence |
GGGCGGTTAGCTCAGTTGGTAGAGCATCTCGTTTACACCGAGGGGGTCAAAGGTTCGAGT |
| Downstream region at tRNA end position |
aaatattaaa |
| Secondary structure (Cloverleaf model) | >WENV180358096 Val TAC
g ACCA aaatattaaa
G - C
G - C
G - C
C - G
G + T
G - C
T - A T G
T T T T C C A
T G A A | | | | | G
T C T C G A A A G G C
G | | | | T T
G G A G C
T A A GGGTC
T + G
C - G
T - A
C - G
G - C
T C
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |