Sequence ID | >WENV180358559 |
Genome ID | OBNP01098134 |
Search identical group | |
Phylum/Class | [OBNP] marine metagenome; seawater |
Species | |
Start position on genome | 77 |
End posion on genome | 153 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tatcttcagc |
tRNA gene sequence |
GCGTGTGTAGCTCAGCTGGATAGAGTACCTGGCTACGAACCAGGCGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tttcttaaan |
Secondary structure (Cloverleaf model) | >WENV180358559 Arg ACG c GCCA tttcttaaan G - C C - G G - C T - A G - C T - A G - C T A T C T T C C A C G A A | + | | | G T C T C G G G A G G C G | | | + T T G G A G T A T A A CGGTC C - G C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |