| Sequence ID | >WENV180360933 |
| Genome ID | OBNU01063827 |
| Phylum/Class | [OBNU] marine metagenome; ENVO:00000021 'freshwater lake |
| Species | |
| Start position on genome | 160 |
| End posion on genome | 87 |
| Amino Acid | Glu |
| Anticodon | CTC |
| Upstream region at tRNA start position |
ctcgtcgcac |
| tRNA gene sequence |
GGCCCCGTTGTGTAGTGGCCTAGCACGCCGCCCTCTCAAGGCGGTAGCGCGGGTTCGAAT |
| Downstream region at tRNA end position |
tgttgaaaat |
| Secondary structure (Cloverleaf model) | >WENV180360933 Glu CTC
c ACat tgttgaaaat
G + T
G - C
C - G
C - G
C - G
C - G
G - C T A
T T G C C C A
T G A T + | | | | G
G T G T G G C G G G C
G + | | | T T
C G C A C
C T A G TAGC
C - G
C - G
G - C
C - G
C - G
C A
T A
C T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |