Sequence ID | >WENV180362780 |
Genome ID | OBNX01038729 |
Search identical group | |
Phylum/Class | [OBNX] marine metagenome; ENVO:00002010 |
Species | |
Start position on genome | 89 |
End posion on genome | 14 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cgcggttaca |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCGCTTCGTTTACACCGAAGATGTCGGGAGTTCGAGC |
Downstream region at tRNA end position |
tttcatcacc |
Secondary structure (Cloverleaf model) | >WENV180362780 Val TAC a ACCA tttcatcacc G - C G - C G - C T - A C - G G - C T - A C G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |