Sequence ID | >WENV180366176 |
Genome ID | OBOC01170824 |
Search identical group | |
Phylum/Class | [OBOC] marine metagenome; ocean water |
Species | |
Start position on genome | 170 |
End posion on genome | 247 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
caatctatgt |
tRNA gene sequence |
CGGGATGTAGCGCAGTCTGGTTAGCGCGTTTGACTGGGGGTCAAAAGGTCGGAAGTTCGA |
Downstream region at tRNA end position |
ttttgtactc |
Secondary structure (Cloverleaf model) | >WENV180366176 Pro GGG t ACCA ttttgtactc C - G G - C G - C G - C A - T T - A G - C T A T T C T T C A C T G A A + | | | | G T C G C G G G A A G C G | | | | T T G G C G C T T A G AGGTC T - A T - A T - A G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |