Sequence ID | >WENV180368267 |
Genome ID | OBOF01046514 |
Search identical group | |
Phylum/Class | [OBOF] marine metagenome; ENVO:00002010 |
Species | |
Start position on genome | 481 |
End posion on genome | 553 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tccaggctaa |
tRNA gene sequence |
GCCGATGTAGCTCAGGGGTAGAGCGTTTCCTTGGTAAGGAAGAGGTCACGGGTTCAATTC |
Downstream region at tRNA end position |
atgaaatgtg |
Secondary structure (Cloverleaf model) | >WENV180368267 Thr GGT a TCta atgaaatgtg G - C C - G C - G G + T A - T T - A G - C T T T T G C C C A G A A | | | | | A G C T C G A C G G G C G | | | | T T G G A G C T A G AGGTC T + G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |