Sequence ID | >WENV180373034 |
Genome ID | OBOI01184348 |
Search identical group | |
Phylum/Class | [OBOI] sediment metagenome; sediment |
Species | |
Start position on genome | 23 |
End posion on genome | 97 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tctgtcgcgg |
tRNA gene sequence |
GCGGGTGTAACTCAGCGGTAGAGTGCCTGCTTCCCAAGCAGGGAGTCGTGGGTTCGAATC |
Downstream region at tRNA end position |
ccaccacagg |
Secondary structure (Cloverleaf model) | >WENV180373034 Gly CCC g TCCA ccaccacagg G - C C - G G - C G - C G - C T - A G - C T A T T A C C C A G A A + | | | | G C C T C A G T G G G C G | | | | T T G G A G T T A G GAGTC C - G C - G T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |