Sequence ID | >W141035562 |
Genome ID | ALLH01000038 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Streptococcus suis 8830 [ALLH] |
Start position on genome | 168 |
End posion on genome | 243 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cttgtttgcT |
tRNA gene sequence |
GGACCTTTAGCTCAGCTGGTTAGAGCTCTCGGCTCATAACCGAGCGGTCGTAGGTTCAAG |
Downstream region at tRNA end position |
attggaggat |
Secondary structure (Cloverleaf model) | >W141035562 Met CAT T ATat attggaggat G - C G - C A - T C - G C - G T - A T - A T G T C A T C C A C G A A | | | | | A T C T C G G T A G G C G | | | | T T G G A G C T T A T CGGTC C - G T - A C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |