Sequence ID | >WENV180376428 |
Genome ID | OBOM01007760 |
Search identical group | |
Phylum/Class | [OBOM] marine metagenome; Seawater |
Species | |
Start position on genome | 182 |
End posion on genome | 258 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcttctgaat |
tRNA gene sequence |
GGCTATGTAGCTCAGATGGTTAGAGCACAGCACTCATAATGCTGGGGTCGCAGGTTCAAG |
Downstream region at tRNA end position |
cttttcggtg |
Secondary structure (Cloverleaf model) | >WENV180376428 Met CAT t ACCA cttttcggtg G - C G - C C - G T - A A - T T - A G - C T G T C G C C C A A G A A | | | | A T C T C G G C A G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T G - C C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |