Sequence ID | >WENV180377270 |
Genome ID | OBON01006653 |
Search identical group | |
Phylum/Class | [OBON] marine metagenome; sea water |
Species | |
Start position on genome | 760 |
End posion on genome | 832 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
taagagtatg |
tRNA gene sequence |
GCGGGCGTAGCCAAGTGGTAAGGCAATGGACTGTGACTCCATCAGTCGCGGGTTCGATCC |
Downstream region at tRNA end position |
agaatgatat |
Secondary structure (Cloverleaf model) | >WENV180377270 His GTG g CCgg agaatgatat G - C C - G G - C G + T G + T C - G G - C C T T T G C C C A G A A + | | | | G T A C C G G C G G G C G | | | T T G A G G C T A A CAGTC A - T T - A G - C G - C A - T C C T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |