| Sequence ID | >WENV180379306 |
| Genome ID | OBOP01014448 |
| Phylum/Class | [OBOP] marine metagenome; water |
| Species | |
| Start position on genome | 378 |
| End posion on genome | 303 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
ttaattatga |
| tRNA gene sequence |
AGGAGTGTAGCTCAATTGGTAGAGCGCCGGTCTCCAAAACCGGAGGTTGCGGGTTCGATG |
| Downstream region at tRNA end position |
gttttaatca |
| Secondary structure (Cloverleaf model) | >WENV180379306 Trp CCA
a GCCA gttttaatca
A - T
G - C
G - C
A - T
G - C
T - A
G - C G T
T C G T C C A
T A A A | | + | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
T A G AGGTT
C - G
C - G
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |