Sequence ID | >WENV180380618 |
Genome ID | OBOR01001734 |
Search identical group | |
Phylum/Class | [OBOR] marine metagenome; ENVO 00002227 |
Species | |
Start position on genome | 1394 |
End posion on genome | 1478 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gaattacaat |
tRNA gene sequence |
GCGGGTGTGGCGGAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGCAAGGCGTGGG |
Downstream region at tRNA end position |
ttggaaattg |
Secondary structure (Cloverleaf model) | >WENV180380618 Leu TAG t ACCA ttggaaattg G - C C A G - C G - C G - C T - A G - C T G T C T C C C A T A A G | + | | | A T G G C G G G G G G C G | | | T T G A C G C T A G A CGCCGCAAGGCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |