Sequence ID | >WENV180382081 |
Genome ID | OBOS01104458 |
Search identical group | |
Phylum/Class | [OBOS] marine metagenome; ENVO 00002150 |
Species | |
Start position on genome | 193 |
End posion on genome | 107 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ctttcttacc |
tRNA gene sequence |
GGAGAGGTGCCAGAGTGGTAATGGAGCAGATTGCTAATCTGTCGACGGGTAACCGTCGCC |
Downstream region at tRNA end position |
cataatccgg |
Secondary structure (Cloverleaf model) | >WENV180382081 Ser GCT c GCCA cataatccgg G - C G - C A - T G G A - T G - C G + T T A T G T C C C A G A G | | | | | G T G A C C C A G G G C G | | | T T G A T G G T A A CGACGGGTAACCGTCGC G + T C - G A - T G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |