Sequence ID | >WENV180387534 |
Genome ID | OBPF01007093 |
Search identical group | |
Phylum/Class | [OBPF] marine metagenome; Sterile flask |
Species | |
Start position on genome | 387 |
End posion on genome | 470 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaatcaattg |
tRNA gene sequence |
GCCCAAGTGGCGGAATGGTAGACGCAGGGGATTCAAAATCCCCCGCCGCGAGGCGTGCCG |
Downstream region at tRNA end position |
aatctacttc |
Secondary structure (Cloverleaf model) | >WENV180387534 Leu CAA g ACCA aatctacttc G + T C - G C - G C - G A - T A - T G - C T G T C G G C C A T A A G | | | | | G G G G C G G C C G G C G | | | T T T A C G C A G A CGCCGCGAGGCGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |