Sequence ID | >WENV180388833 |
Genome ID | OBPI01000183 |
Search identical group | |
Phylum/Class | [OBPI] marine metagenome; Sterile flask |
Species | |
Start position on genome | 1572 |
End posion on genome | 1646 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaaattcaaa |
tRNA gene sequence |
GGGCTATTAGCTCAGTTGGTTAGAGCGCGCCCCTGATAAGGGCGAGGTCTCTGGTTCAAA |
Downstream region at tRNA end position |
gggtatagct |
Secondary structure (Cloverleaf model) | >WENV180388833 Ile GAT a ACgg gggtatagct G - C G - C G - C C - G T + G A - T T - A T A T A G G C C A T G A A | | + | | A T C T C G T C T G G C G | | | | T T G G A G C T T A G AGGTC C - G G - C C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |