Sequence ID | >WENV180389941 |
Genome ID | OBPK01005402 |
Search identical group | |
Phylum/Class | [OBPK] marine metagenome; Sterile flask |
Species | |
Start position on genome | 489 |
End posion on genome | 414 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
agacatcaaa |
tRNA gene sequence |
GGGCCCTTAGCTCAGCTGGGAGAGCGCCTGCATGGCATGCAGGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
ttttccaaaa |
Secondary structure (Cloverleaf model) | >WENV180389941 Ala GGC a ACCA ttttccaaaa G - C G - C G + T C - G C - G C - G T - A C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |