Sequence ID | >w002178 |
Genome ID | AAAW04000005 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Desulfitobacterium hafniense DCB-2 [AAAW] |
Start position on genome | 52572 |
End posion on genome | 52495 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
atttaacatG |
tRNA gene sequence |
GTGGTTGTGGCGAAGTGGTTAACGCACCGGATTGTGGCTCCGGCACTCGGGGGTTCAAGT |
Downstream region at tRNA end position |
Ttacgacaaa |
Secondary structure (Cloverleaf model) | >w002178 His GTG G CCCA Ttacgacaaa G - C T - A G - C G - C T T T - A G - C T G T T C C C C A T G A G + | | | | A G A G C G G G G G G C G | | | T T T A C G C T A A CACTC C - G C - G G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |