Sequence ID | >WENV180399501 |
Genome ID | OBQO01000018 |
Search identical group | |
Phylum/Class | [OBQO] marine metagenome; ENVO:00002010 |
Species | |
Start position on genome | 14939 |
End posion on genome | 15013 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
caagaatgtt |
tRNA gene sequence |
CGGGATGTAGCGCAGCTTGGTAGCGCATCTGTTTTGGGAACAGAGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
atttgcttta |
Secondary structure (Cloverleaf model) | >WENV180399501 Pro TGG t ACaa atttgcttta C - G G - C G - C G - C A - T T - A G - C T A T T G T C C A C G A A + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C T - A T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |