Sequence ID | >W141038472 |
Genome ID | ALVV02000071 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Leptolyngbya sp. PCC 6406 [ALVV] |
Start position on genome | 167359 |
End posion on genome | 167283 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agtagagcga |
tRNA gene sequence |
CGCGGGGTAGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCCATGGTTCAAA |
Downstream region at tRNA end position |
aatagacaaa |
Secondary structure (Cloverleaf model) | >W141038472 Met CAT a ACCA aatagacaaa C C G - C C - G G - C G - C G - C G - C T A T G T A C C A T G A A | | | | | A C C G A G C A T G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |