Sequence ID | >WENV180407973 |
Genome ID | OBUS01000039 |
Search identical group | |
Phylum/Class | [OBUS] human gut metagenome; faeces |
Species | |
Start position on genome | 162907 |
End posion on genome | 162834 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cacccgcaat |
tRNA gene sequence |
ACGGAAGTAGCTCAGTCGGTAGAGCACTGGTCTCCAAAACCAGGTGTCGGGAGTTCGAGC |
Downstream region at tRNA end position |
gagcggcaac |
Secondary structure (Cloverleaf model) | >WENV180407973 Trp CCA t GCgt gagcggcaac A - T C - G G - C G - C A - T A - T G - C C G T C T C T C A T G A A | + | | | G C C T C G G G G A G C G | | | | T T G G A G C T A A GTGTC C - G T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |