Sequence ID | >WENV180409137 |
Genome ID | OBUU01000043 |
Search identical group | |
Phylum/Class | [OBUU] human gut metagenome; faeces |
Species | |
Start position on genome | 85457 |
End posion on genome | 85531 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
atcaaactcc |
tRNA gene sequence |
GGTGGGTTCGTCTAACGGTTAGGACACATGCCTCTCACGCATGTAATACGAGTTCGATTC |
Downstream region at tRNA end position |
aagaaaaaga |
Secondary structure (Cloverleaf model) | >WENV180409137 Glu CTC c ACCA aagaaaaaga G + T G - C T - A G - C G - C G - C T - A T T T T G C T C A C A A C | | | | | G G T C T G A C G A G C G + | | | T T T G G A C T A A TAAT C - G A - T T - A G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |